EST 1077671 is a singleton


Sequence

>1077671 (1 EST) Length=257 AGTTTCTGTACTATATTGAAGCACACACGGGGAGTAGCAAAATCAAGCTGTCGAAGAAAGCGAAGGGAAAAGAGGGAAAG TGTGTGTGTGTGTGTGTGTGTGTGGGAAAGCGAGGAAGTAAAAGATGAGCTCTAAACTCTACGAGACGCCGGAATTGGTG GGCGACGAAGGGCTTCCACTTGTGAGTGAAAACCCGTCGCCACAGGAGCCTCAAACGCATGCGTTTGACGCAGAGCAGCA AAGCAGAATCAACGAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1077671: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10776712130854AA433377TEUF0251T.cruzi epimastigote non-normalized cDNA Library


Date: 0:48:30 on Wed 22 Nov 117.