EST 1077673 is a singleton


Sequence

>1077673 (1 EST) Length=234 GTTTCTGTACTATATTGACGAGCCGCGCGGAGCCTCATCACGAGAATTGTGACAGCAGGGGAGAAATCCGGCAAACGATT GCTTTCTTTGAGACAAATAAATAAAAAAGACAAAACAAAAGGGAATAAAATTATCTTTAAGAAGAGGGGGGCCGTGAAGT TGTTTCTTTTCCCCTCCTTTAGTAGAGTCGTCCGCCCACTCACAGTCGCCGTCCCTCCTTTTTTTCCCGCCCTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1077673: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10776732130856AA433379TEUF0254T.cruzi epimastigote non-normalized cDNA Library


Date: 7:17:6 on Sun 19 Nov 117.