EST 1077675 is a singleton


Sequence

>1077675 (1 EST) Length=252 ACCTTCACGCGGTTGATGAAACGACCAAAGGACAAGAATTGCCGGAACATGAGGGGGAGGAGGAGGATGTTGGTGAGCAG GTGCTGGAGGATGCCGTCAGCGGACCGAGGAAGAAGCAACATTATAAGGCGACTGTTGCCCTGCTACGAAGAGTCGTTTC TTCTTCCTCTTCGTTTTCTTTGTAGTCAAGACGCGTGCTATGGAGGTGAAGTCTGTGGGTGAAATGTACGCCGCTTGCTC TTCACAAAATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1077675: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10776752130858AA433381TEUF0256T.cruzi epimastigote non-normalized cDNA Library


Date: 22:8:10 on Fri 17 Nov 117.