EST 1077678 is a singleton


Sequence

>1077678 (1 EST) Length=342 GTGCCTGGTATCTCNNCCGAAAAAGAAAAAAAGTAAACAACAAAAAAAGAGTAAACGAAGGTTCCATCGAGAAAATGGGG GTGGGAGGGGCAAATTTTAAATTTTAAATTTTAATTTTTAATTTTTAATTTTTAATTAATTGTCATTTTGGCTTTAAAAC CAAGGAGAAAAAAGGGGTTTGGTGGTGTGTGTGTGGGGCAACGGAAGAAAATAAAATCGGTGACGTAATAAGCCGCTAAA ANCGACGGCGAGTAGTGGAGGAAGTGCATCGCTGNAAAAAATGCGTGTTTTGGGGGTATTGTCACTGGGGAGTTTTTTTA TTNGAAGGGNAAGGGGGGTGCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1077678: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10776782130861AA433384TEUF0026T.cruzi epimastigote non-normalized cDNA Library


Date: 10:8:58 on Fri 24 Nov 117.