EST 1077680 is a singleton


Sequence

>1077680 (1 EST) Length=233 CCTTTTTTTTTTTTTTTTTTTTCAGTCTTCCTTTTTTTTTTTTTTTTTCTTCGTTCCTTCCCCCACTTCCTCTTGCTCCT TCTTGCCAACAACAATTCCCAGAATGCCCCACTAATGATCTGCCGTCGTTAAGCCCGAGCCTCGAACATGGGACTTGGCA CTCAGCGGATCAGCAAGTCGTGGGCTTTTCCACATCAGCTTCGGAACACAATATTGGGAAGACGAGGGCATTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1077680: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10776802130863AA433386TEUF0264T.cruzi epimastigote non-normalized cDNA Library


Date: 12:39:47 on Sat 18 Nov 117.