EST 1077701 is a singleton


Sequence

>1077701 (1 EST) Length=601 CAAGTTTGAGTATGTGGTGCTATAATCAAAGAAATTGAATTATTTAACAAAAAGCGACTACTCACTGGTTACGTCGACTC CATCGCAGCTCGTATTGATATACCTTCGACGGAGATCTGGCGCTGTTTCAATTCTCTCATGCNGCTGCATAATTATGTGC GTAATAACAAGTGGAATGTAACACATTGGATAAAAGATCTTTTTTGTTAAAAGGTCTTATTTTCTTCAATATATTCAACA AATCTCATTTGATAGCAGGCTTGCTGAATCTAGTCTGAAGGATATTTTGTCNCGGAATTCCTTCGATGATGAGTTTATCA AAGCAGTCATCGACTTTATGGATACTGAGCAGTCTTGTAAACCTACCATANTGAATGCTATATCTAAATATCCGCCATTT CGATCTCTTAATTGCCGTTTACAGATTACGATTGGCCGAATGGTTTTGTTGCATTCACCGGATATAATGCTTCAATTTTG GCTTCGTGTTGGTACTGGTGATGATTGGACAACTGGTATTGATGTTTGAGACTTCTGCTTCCATGGAAGANGANAAAATT TCCTTGGTGGATCCTGGGATGCTAACCGATTAATTGAAGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1077701: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10777012130884AA433407SWAMCA1624SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 21:51:54 on Fri 17 Nov 117.