EST 1077703 is a singleton


Sequence

>1077703 (1 EST) Length=197 GTCTTTCTCAATAATACGTGTATTGAGACATTTGCCGTTTTATTTTATTTTTTTCCTTTTATTTTTCTTTTACTCAACAA ATGCTTTATATGGTATAATTTTATAGCGTCTTTCCAACCCTCTGATGAATTAAATTCCACNAACATTTTATTGGCATTTT ATTGGTTTATTAATGTGGCATAAACAGTTATACTAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1077703: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10777032130886AA433409SWAMCA1626SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 2:23:11 on Thu 23 Nov 117.