EST 1077730 is a singleton


Sequence

>1077730 (1 EST) Length=417 GTGATTTTCACGCAGCCGGTGCCGAATTCAGGGTCGCAGTAGTCATCCGCAATAATCGGGATGCGACGGCCAACCAGCGG CAGCTCGACNAACTTGCCGATCAGCGCCTGGTAGCGTTCGTCATTCGGGTTGACCGCGACGGCGGCATCACCAAGCATGG TTTCCGGACGGGTGGTGGCGACNATCAGGTAATCATTGCCTTCGGCGGTCTTGGCGCCGTCAGCCAACGGGTACTTGAGG TTCCACAGGAAACCTTTTTCGTCGTGGTTTTCCACTTCAAGGTCGGAAATCGCCGTGTTGCAGCTTGGTGTCCCAGTTGA CCAGGCGCTTGCCGCGGTAGATCAGGCCGTCTTCCATGCAGGCGCCACNAANGCTTCCCTTCCACGGCTTCCCGANAGGC CATCNTCCNTGGTTAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1077730: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10777302130913AA433436SW3ICA2672SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 23:15:46 on Fri 24 Nov 117.