EST 1077744 is a singleton


Sequence

>1077744 (1 EST) Length=440 CTTAACACTAATACTTATATTTTAATATTTCATGGCATAAAATTTGTTCATAATACTTCNATTTTCTATTAATTTGATTT TATAACACAATATCTTTCATCCATCCTTGTTTGAGGCTTCATAATAATAATAATAATAATATTAATCGCGGCAAGCCATT ATAAGTTGGAAAAAATTAATTCCTTTGATTTATATATTATTATTATTGTAGAAAGATGTTGCATGTTTTATTACTATTTC TTTTCAATTTCCCCGGTATATTTGGTGCGCTTGGTGGCTTAATCGGTCGAACGCAAAGTGCGGGTATTGAAGGTACCCTT ATGTGTGATGGAAAACCACTTGGTGGTGTTCTTATCAAATTATATGATGATGATAGAGGTACTGATACAGACGATCTAAT GGCAAAAGGTAGGACAGATAGTAAAGGTCATTTTCGTATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 1077744: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10777442130927AA433450SW3ICA2338SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 5:2:16 on Sat 18 Nov 117.