EST 1079747 is a singleton


Sequence

>1079747 (1 EST) Length=200 GCAAACATTACAAAAGATATTTTATATGAGATTGTTCATCAATCCACTAATTCTATTCTCGCTTCTATTCTTTTATACGT TGCCTGGCAATCAGTTGTGTGAAAGAGTGTTGGAAGACGATGAAATTAGATTTAAATTAAAGAAATGTTTTATTTTCTAG GGAAAATTTATAAAGCGCTAAAGAAAAATAAAGATCAAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1079747: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10797472140367AA435453SWAMCA1585SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 1:9:20 on Mon 20 Nov 117.