EST 1079751 is a singleton


Sequence

>1079751 (1 EST) Length=927 TGAAATACCGAATTTAAGCGATGAAAATGAAGCTGATGAAGTGGTTATAACTCCATCAGTAACAACTAGTGGACCTCATG AAGACCGAATAAGACATCTTCTAAATAATGAGGTGGCTATATTTTTACGTAAACAGTTAGCTGTTTNTATTCGAGAATTG AAGGAAGAATTCAGCAAAGGCTTGATATTACCAACTGATCGTGCGAAAGCACAAGTGGTTTCGAAGGGAAAAACAACAAT TGGAAAGCAGCATGTTGATAAGAGGGCATTCCAGAATCATGTGGTGACCAGTGCTGACAACGATCTCATAAAATCTGCGC CAGTCAGCGTCNATGTTAAAAGCTTGTCGTTTGTGGAGTCATTCAAAGTTCAGCCANATCAGTTGTGGGAAGTACTCNCA GAAGCTAAAATGGTGAAGAAATGGTCTAACAACGATGCAGANCTTGATCTCNAACCTCATGGCGTTTTTACATTATTTGG TGGCATGGTTACGGGTGAATTCGTTAAAATTGANCCCTGTTAGGAACTTGCAATGAAATGGCGCTTAAAAACTTATCCNC CCAGGATGTTTTGCAAATGTTACCTTTAGATTNNNAGATGAGAAAGATGTTCCCCCCTNGAANTGGATGTTAAANGTNTC CCCCCAACANAATNTGACGGTACTGAAAACGGTTGCATCCTTTTTATTTTCCGAACNTTATGAGGAACNTTGGATTTGGA ACCNTTTTTTCNGAAATTCGGCTTTAACCCCTTTTCACNAATCNTTTCTAANCCCNTTCCCCGNGGAATTCCTAACCCNG CCTATTTAATTAACCTTTTTTGAAAANAAATTCCNTCCGAAAGCTGGTTCCCTTACCCGGCNCCNTTTTTNGNGCGGGAA AAAAANAAAACCTTTTTCCAATCCTTTNCAAAAANTTTGGGNAANAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 1079751: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10797512140371AA435457SWAMCA1589SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 8:56:10 on Tue 21 Nov 117.