EST 1079773 is a singleton


Sequence

>1079773 (1 EST) Length=551 CTTTATATTAATTTCAAACGAACCTATCATCCATAACTCCACATGTGAGTGAGATGCTGGATTGCAAAGCGTCTCTTCTG TCCCAGAAGACTAGTGGACAGGATGCGAGCATATTGGCATGGTTGAGTATATCAGTAGTTGTGGGACGTTTGTGCACTTG TCGGTGATACCGTTGTTGACATTTGTCGTGTTATACGCGTGGTACGTCAAGCGACACTCATGCGTGAACCACAACATGGC GAAAGGGAAGCGTCCGTCAACGTCAATACGAATGTGCTATGTGTTTGGGTCTGGCGGCCACACTGCTGAATTATTAACTC TTATATCCGCCTTTAGACAACAGTTCGGTCATCCGTATATATATTGTTTCCGATACTGACAAACTAAGCCGGACGAAAAG ATAATCGAATTTTGAAAAATCGCAAACCTNGGGAAACTTCCCGAATTAAAACGAAATAANCCAAAATTCCGGGAAAATTT AAAACCAAACTTACTTTACTTCCAATAATNGGACAACAATTTTGGGCCCGGCNTTGGAAANCTTTATTTNC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1079773: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10797732140393AA435479SWAMCA1723SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 1:38:35 on Sun 19 Nov 117.