EST 1085987 is a singleton


Sequence

>1085987 (1 EST) Length=502 ACATGAAGACAAGGNAACAGGAAGAAGAGCAAAAAGCTCGAACTGCTTATGATTTGATGCGAATGAGATTGGAAAGATTG CAGAAAAATATTGAAAAACCAGTGTCTATACCACAACGACGAGATGGTCGGAAGCCACGACCGCCGCCAGATTTCGTCCG TAATGTTGTTGGTTCATCAGCCGCTGCTGGAAGTGCAGAATTTCACATTTTTCGGAACAATCGAAAACGAGAAATGGATC GGTTGGATTATATGAATAATAAAGCCTTGCAAGAAGAACTGGATGAGAAATTTTTGGCTGAAAGAAGAAGACGGGCGGAG GAGGAAAGAAAAAAAAAACAGCTTAGAAAACGGTTAAAAAGGCNCGTTTNCCAAGAAAAGATGAAGAGCTTTNNAAAAGA AAAATGAGAAAAGTTNGTTNCNGAAAGTTGAANCTGATGGAAATGATTCCGAATTTGAATTTCCACTTGTTGGAAAACCA GGATTANATTTCCAANCCCGGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1085987: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10859872153571AA441693SW3ICA2504SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 17:1:38 on Wed 22 Nov 117.