EST 1085996 is a singleton


Sequence

>1085996 (1 EST) Length=431 GCAATAATGGCGGAAGATATTGATGAGATTCTGGCTGAAATTGATGGCTCACAAATTGAGGAATATCAAAAGTTCTTCGA CATGTTTGATCGTGGTAAACAGGGCTACATCATGGCAACACAAATTGGCCAGATTATGCATGCGATGGAACAAGACTTTG ATGAAAAGCAACTTCGAAAGTTGATTCGTAAATTTGACGCTGATGGTTCTGGAAAGATTGAATTTGAAGAATTTTGGGAA TTAATGGCCGGTGATGCTGACTGAACAATAACAGTTGACAATTTCTAACCTTTCTTTTTGAATTTAATTACTGGTACGAA AATCTGCCTATATTTATCCGTTTGTTGTACTATATGTTTTATCAATGTTTATAGAAATATTTTTAAGAATATGAAATAAA CNTTATTTAAATNTNATTTAATAAACGAACC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 1085996: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10859962153580AA441702SW3ICA2517SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 5:49:48 on Sun 19 Nov 117.