EST 1086025 is a singleton


Sequence

>1086025 (1 EST) Length=254 GAAAAAAATTACCTATAAACTATTTGGGTAAAAAAGGAGAGGAATAAGCCTGAAAATATGCTAAGTAAAAAGAAAAAAAA AAATNCTTTCAGGTNTTGAANTNCAAATGGAAAANCAAAAAAAAAAGGAAAGGAANTTGTCGGTTGGTGAAGGAAAAAGG ATGGAAAAAAAAATNTTGTAGGAAAAANTGCCTAAAAAAATTAAAAAAATNTCGATNATGAANTGCANCTAAAANGGCCT TAAAANCTANGGTN


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1086025: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10860252153609AA441731SW3ICA2554SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 15:2:9 on Fri 24 Nov 117.