EST 1086028 is a singleton


Sequence

>1086028 (1 EST) Length=169 TGTGGCACAGNAGATTATTCGGCTGCAATAGTCACATGATTTATCCTCTGACGCTGCGCATGCAAGTTGTTGGTCACGGC AAGTCTGCCTCGTCTTTGCCGTTCTGCCGCACGCCTCNTTATGGCTGAAGATTGCCAGCCGCGATGTATTGACGCCGTCT GCAGGTGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 1086028: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10860282153612AA441734TEUF0274T.cruzi epimastigote non-normalized cDNA Library


Date: 14:59:1 on Wed 22 Nov 117.