EST 1086029 is a singleton


Sequence

>1086029 (1 EST) Length=213 CAATATTGTGGTCAGCCTCATGCTGGCCTCAAATCCCAGCATTCGGGAGGTGTGTGTCTTCTTCAACGACTGTCTGCTGC GTGGAAACTGCTGCTGCAAGCTGCACCATACATTTGGGGCCTTCTGCAGCCCGAATTACCCGTACTGGGAATGGTTGGAG TCGACGGGCTTCCACCTTCGCGAAGCAATGCTGCTGCCCGCAGCCGAGTGGAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1086029: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10860292153613AA441735TEUF0277T.cruzi epimastigote non-normalized cDNA Library


Date: 2:37:47 on Sat 25 Nov 117.