EST 1086033 is a singleton


Sequence

>1086033 (1 EST) Length=232 GTATTTGTAGATAGAGCCGGTGGGGAAACGAAGAGGATTACACACATGCACGCAAAAAACAAAAAAAAACAACAAAACNA AACATGCAAAGAGGAGAGAAGTCCACTTAGAAGAGAGGGACAGTAAAGAAGTAGACAAATACGCAGGCGTAGAGCGACGC CATAACGGAATGTATGGAATAAAGGGAAAGGGGAAGAAGAAACCGAACAGGGTGGTGGCTCGTCCTGAATGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1086033: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10860332153617AA441739TEUF0284T.cruzi epimastigote non-normalized cDNA Library


Date: 2:41:21 on Mon 20 Nov 117.