EST 1086034 is a singleton


Sequence

>1086034 (1 EST) Length=195 GTCTTCCTTTTCCATTTGGAGGTGTGAAGAAAGATTCCATGCGGTGGCTTTTGCCAAAAAAAAAATGTTTTAAATTTATT TTTCTTTCTTTTTGCGGCGTTTTTTCTCTTTTCTTTTTTTCTGGATGCTGTGGACCGTCGGCAGGTTTTTGAACGGGCAT GGACGTGTGCCCAGACAAATGCCAACGACCCTCTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1086034: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10860342153618AA441740TEUF0286T.cruzi epimastigote non-normalized cDNA Library


Date: 6:44:21 on Sat 25 Nov 117.