EST 1086036 is a singleton


Sequence

>1086036 (1 EST) Length=187 GGAAATTCTCTTTGACGCCAAATGGCATCAGTACAAACTCGGCCACACAGCCCTTCGCTCGGTCTCGAAGGTGCTTGACA AATATTTCCCTTTTGACGAGAAGCGGGTGTTGGCACTGGTGTCGAAGAAGACCGGGCAGCCCGTGGAGTAGNTGAAGCCG CGTTGGAACCGACAAGCGTTGCTTGGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1086036: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10860362153620AA441742TEUF0288T.cruzi epimastigote non-normalized cDNA Library


Date: 13:33:21 on Thu 23 Nov 117.