EST 1086037 is a singleton


Sequence

>1086037 (1 EST) Length=297 GGTTTCTTTACTATATTTGAGTCGTTTCAAAGAAAAAAAGGGGATGGCGCATTTCCGGTCCCTTTCCATATCCCATGGAC GATAGAGAACAGCAACTAATCTAGTGGGAAGTAGTGGCGAGTCTAAGGAATTGTCGTCCGGCCGCGGTGAGTTGTCGTCN TCAAGTTGCTCCCTTACCTCCANTTCGAGTCATGTCCGTGGAAACCCCGGAAAGGGCTGTTGTAACGCGTTNGGAAGGGA GCGCATGGAGCGTCAACAACGGCTCNAATGGTTGCTCTCGCCGCGCAACTTTGGTCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1086037: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10860372153621AA441743TEUF0028T.cruzi epimastigote non-normalized cDNA Library


Date: 4:31:5 on Wed 22 Nov 117.