EST 1086041 is a singleton


Sequence

>1086041 (1 EST) Length=304 ATTTCTTGAGCAACGTTCACCGGAGCTTCAAAATCGTTACCAGGAACTTCTTACCCGCTTTAAAGGTTCTGTTGGACCCG TCTTTACGTTAGTTGACGGGAAAGATGGTGAGACATGCTTCTCTATGGCTATTGCTGCCGATCGTAACTACTACCTGGCA TCGCTCATGGCGATCATACGCGAAATTCCAGGAGCGGTGGTAATTCGCAGTTTTTCCGAGACCTTTTCGAATGGCGTTCA TATTTACACGCTTTACAATGATGGGGCTACTGGGCACGCAGCTGCAGGATCGGGGTTCCATGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1086041: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10860412153625AA441747TEUF0298T.cruzi epimastigote non-normalized cDNA Library


Date: 18:16:38 on Fri 17 Nov 117.