EST 1086042 is a singleton


Sequence

>1086042 (1 EST) Length=392 GNGATGGAGACTGNCCGAAACCTCACGAGTTTTTCGAGGTCCCATTCAAATTTACGGGGGAAGGGGGACATGGTGTCTGA GGGTGTATNTCCCATGATTCCTGATTTAGCAACGGTTCAGAGCGATGCACACTCTCAGACGGCTCCAACGTCATTTAATC AGCAGCATCTTAGTTCTCTGAGGAGTCAAAGTCAACGGCGTCGGTCGGAGAGCACCGGAAGCTTGAGGAAAGATTGAGGG ATTTACTGCGAGACCTTTCAACAGTGGATCCTTCATCCGTCCCATCTACAGCTGTTTTCACAACCNTTNTGCGGACTTTT GGAAAAAGCAGCAAGGNGGTAATTNAAACGTTTTTCAAATAGGGTTTTNGGGGGTTTAACCGGGGGGATTCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1086042: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10860422153626AA441748TEUF0030T.cruzi epimastigote non-normalized cDNA Library


Date: 10:42:6 on Tue 21 Nov 117.