EST 1086045 is a singleton


Sequence

>1086045 (1 EST) Length=291 GTTTCTTGACTATATTGAAGGAAAGGTTGGGTGAGAGATACCTGNGGTTAAATTATTCATATTTTAATTTTAATTTTTTT TAATTTATAGACCGATATATTNTTTTTGTTTTTTTTTTTGTTTTGGCGATGCTCACGTACGTAGTTGCCNGCGGTCATTA TTTAACTCACGGTATGTCTGTCCTTAAAGAAGGGTGTGTTTTCCTCCCCTCCCATGGGAGTGGCATTGGATGCGTCTAAA TTCCAGAACTTTAAGCTTGTGGGATAAAATNACTGTGAGTCACAACAGTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1086045: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10860452153629AA441751TEUF0037T.cruzi epimastigote non-normalized cDNA Library


Date: 14:59:27 on Wed 22 Nov 117.