EST 1086046 is a singleton


Sequence

>1086046 (1 EST) Length=290 GGTTCNTTGTCTATATTGGAACCAAAGCTCCCTGNTCCCACAGAAGGAAAAGGAACGATTGCAATTCCCTAAGCTGTTTT CCCACAATNACACATGCACCGAATGCAAATAAGCCAACAGAGCAGCCGACCCCCATGCAGACTGCGGGCTCAAGGCTGCC AGCTGCTGGCTCCGCCCCAGCACTTTTAACCGGGGAGGAGGTGAGGGTGCCGATGTTTGGGGAAGTGGTTCCCACAGAAA TGGAAAGTGGGCAAAAGAACGGACGTNAGCAACCAGGAAAAAAATTGTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1086046: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10860462153630AA441752TEUF0004T.cruzi epimastigote non-normalized cDNA Library


Date: 13:8:15 on Sun 19 Nov 117.