EST 1086048 is a singleton


Sequence

>1086048 (1 EST) Length=312 GTTTAATGCCATTCCAACGAGTGTATTTGACAGGTTCAACGAAGCGGATCGTATATTANACCCACAATCAGGAAAGATAA AAGATGGGGTGAAAAAACGGAACTTTGTGGGACTAGGGCCACCTACACAGAAGTTCTCGGGGTGTTAAGGTACAATTGGT TGAGAAAACATGATGATAATGAAACTTTCACGCATAACCACTGTAGCTGCTGATAAAAAATAATGATTAGAAAGAAAGAA TATTATATAACTGGATACCTTTTTTGGTGTGTTGTCTTTACCTCTCCTGTTTTCAAAGGTGTATCNAGGTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1086048: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10860482153632AA441754TEUF0041T.cruzi epimastigote non-normalized cDNA Library


Date: 4:40:58 on Sat 25 Nov 117.