EST 1086049 is a singleton


Sequence

>1086049 (1 EST) Length=264 AAAAGAGGACTCCATGNGGGCAATTATAAATAATCGCCGTATTCGTTGGTTTNNAACCCGNTTTGCCCTGCTTAAGGCGT ACCATGAGGCCCACATTGCGGGGGTAGTTTTAAAACTTCGCCTAGCGTTAAGTGCAGCTNTTTTCCTGATGCTTTGCTGG ACTCTTTTCTCCCTCGTCCTGCGAAGCTTTCAAGGTGCGCAGAAACAGTGACGGTGGGAATAATTCAACACCTTTTGGTT ATGCTCTTTCCGTCATGGGTGACG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1086049: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10860492153633AA441755TEUF0043T.cruzi epimastigote non-normalized cDNA Library


Date: 19:45:56 on Fri 17 Nov 117.