EST 1086056 is a singleton


Sequence

>1086056 (1 EST) Length=385 ANGCCAAGCAGCGATCGATGTGACTNNTTCTTTCACGGAGGATGCAAAGCTACAGAAGAGGAGACGTCTGGAGATTATAA AAGTTGGGGATGAGACGGAAATTGAGACTGATGCCGNAAGTATTCATGATTCTAACATTTCAGGTTCTACCGAGCATTGC CGACGCATGCAATTAGTTTGCTGCGCTGGAGAACTTTCTTTTTATGTGTCTTCGAATTCGTCCGGAGGATCGACCGACCT GCGAGGAGTTGTTGCTCCACCCCTTTTTCACCACCATCTGAGAATACGCTCGCTTGTGTGTGTGTGAAAGAAGTGGCTGG AGCAAACATGTGGCCGTTTTTTAGCGACCCAAGCTTGGTTAATAGGGTGTGGATCCAAGATGGGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1086056: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10860562153640AA441762TEUF0055T.cruzi epimastigote non-normalized cDNA Library


Date: 19:16:12 on Thu 23 Nov 117.