EST 1086060 is a singleton


Sequence

>1086060 (1 EST) Length=474 GGGTTCCAATCTGACAGTAAGGAAGAGCGAAGGGTTGTTTTCATGCAACGGTCGTCGCAAATCCGGCAAGAAGGACATCA GCAGCAGCAGCAGCATCATTATTATACACAGTCGAAAAGATTCCCTTCGACCGAGCAGTTGCCAGATAAACCTGAGAGGA TTGTAAAACTTTCCCCCATTCGCCAGAGAACTGAGGCTGAAGTTACGAGGCCCCGGCCAGCTTTACTGAGCGCGGTGAAG TCACGTTCCTTTGGGGTGGTGCGTTCACCGAAAAGGAGGGAATCCTTCTCCGAACCGGTGCACGGCCGGCATATGTCATA TGACAAAGGTGGGACTATGGGGCATGATGCCTCCTTGTCTCCACGTCGGGCACTTCCGCCACGGAGGTTCGTCGTTAAAG GCGGCGTANGGTGGGATTTCCAAACGGTCAAATTAACCCTTCTGTTTTCCAAAGGTTAAAAACAGCAGGAACGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1086060: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10860602153644AA441766TEUF0006T.cruzi epimastigote non-normalized cDNA Library


Date: 8:24:56 on Fri 24 Nov 117.