EST 1086063 is a singleton


Sequence

>1086063 (1 EST) Length=208 TTTCCACCTCTCTGGTGTGTGGAGGTCCTCCCGTCCTCTCTCGGGGATGTCCGTCTCGGGGATTAACGCGCCATTCCCGG ACTAAAAGAGACGGAAGAAAAGGCGGAAACAACGACGGGGGTTTTAAGCACAAACAAAAAGGTGGTCAACGAAAAAAAAT AAAAAAAAAAAGAAGAAGAGGGAAAAGAAGAAATGGAGAAAAAGTTGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1086063: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10860632153647AA441769TEUF0071T.cruzi epimastigote non-normalized cDNA Library


Date: 2:49:24 on Mon 20 Nov 117.