EST 1086066 is a singleton


Sequence

>1086066 (1 EST) Length=331 AATCCGATTCCCCCGCGAGGGAAAAGGCATGAAGAACAGGGCAACAGGCTGGGGAGTGCAGAGGGCATGGCATTACTTAG CGAGGAGTGGGGACATTCTGCACTGGTGTCGTGATAAATACCGTTTTAATCAGCCGCAGGCAAACTGCGCTGGGAAAGTG GTATGTGCATATCCAAAAGGAAAGGCCAACTTGTGCGTAGGCATGTCACTTGTTTGGGTCGTCGGGCGTTTTCCATGTGG TTGGCACAGGCAGCAATACATTGTCGTCGTATGCTCCTTATTTGTGTTCATCGTAAGCGGCACNGTGTCGNCTGAATATC ACATTTTTGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1086066: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10860662153650AA441772TEUF0008T.cruzi epimastigote non-normalized cDNA Library


Date: 14:39:32 on Fri 17 Nov 117.