EST 1086069 is a singleton


Sequence

>1086069 (1 EST) Length=305 GTTTCTTNTCTATATTGGGGATGTCCATTGCCCTTGGCATCGTCGCGGAGGATGATGAGGCATGGCGAATTGCCAGCAAG GCTGTCGCTGTAGAAAAGGAGCCTGTTTTCAGCGGGAACAACGGCCCTTTTTTAGATGTTTGGTTTGGCGAACATAAACT CTTTGGCCTCGTTCAACGCGTTGCTCCAAACGACTTTATTCAGGTCGCCCAGGAGTTTGGCGAGAGGAGTGATGACGCCG CGGCCACGTCGCGGATACGTNTNACGNACAACGTCTCTTTTTGTCCTTNAACTCTCGTCGGTGCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1086069: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10860692153653AA441775TEUF0088T.cruzi epimastigote non-normalized cDNA Library


Date: 2:43:50 on Fri 24 Nov 117.