EST 1086070 is a singleton


Sequence

>1086070 (1 EST) Length=249 GGCCTCAAACAGACTGAGGAAGCGGAATAACAAGCTGGTGAAGACGTGGGGTGAGAAAAGGTGCGGCACGCGATGGTTTC TCCGGTCATTAGTTTCATGGATGCCATCCGCAGTCGTTACGGCTCGCCGGACGACAGCGAATTATACGGCACGGATGCCC TTCTTTGTTGGGGACTCCAGTCGCCGGCGCAACAAGAAAGTGGGACTTGTCGGCATGGAAGAAACGCCGGGTGAAGCAGG CGGGACACA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1086070: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10860702153654AA441776TEUF0090T.cruzi epimastigote non-normalized cDNA Library


Date: 9:35:25 on Thu 23 Nov 117.