EST 1086071 is a singleton


Sequence

>1086071 (1 EST) Length=335 GGAAAACGAGGGGGATGGGTGNGGTGTGCGTGTAAATATGTGTACCTGTGAGCTTGTCTGTACGTTTGGGGTGATAAGGC CAATAGCGCCAACGGGTGCTGCCGCTGTGGAGCGAGGAGAAATTAAACAACAACAACAATGATAAAATAAAAGGAAAAAA AAAGGAAAAATAGGCTGGAAATTACATTTTTAAATACACAAACGCACAGGCAATATATGTATGTATGTATGTATGCATGC ATTGCAGGGGCCAATGAAATNTGAACCNCGGTNGAAGGGAAAGGAGCCCNNCAAGNCCACCACACCCCAAGTGNTTTGGG GGGCCCCCCCCCCTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1086071: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10860712153655AA441777TEUF0092T.cruzi epimastigote non-normalized cDNA Library


Date: 13:27:49 on Fri 24 Nov 117.