EST 1086074 is a singleton


Sequence

>1086074 (1 EST) Length=200 GGCGTGCGTGATGCGGCCAAGGTGGAGAAGTGCACCGGGACGTTCCTGCCGCTCTGTGACGCAGTCCGCGACGAGTGGCT GGTGCCTGCGGGCATTCGCATTGAGGACAACCCTGCTGGTCCAACGACGTGGAAGAGTGACGATGTGGCTGTGCTCCAAC GCGAAGTGGCAGACGACGGGCGCAGCAAGCAACGGAGCGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1086074: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10860742153658AA441780TEUF0097T.cruzi epimastigote non-normalized cDNA Library


Date: 13:34:10 on Thu 23 Nov 117.