EST 1086075 is a singleton


Sequence

>1086075 (1 EST) Length=261 GTTTCTGTACTATATTGTTTAGGTAGACGCCAGGGAAAAAGAATAATATTGACGCGGATTATTTTCTTTTATTTTCATAT ATTTTTTTGTATATAATATATATATGTGTATTTTTGCGCGTCATGCCTACAGATGCGGCGTGGCAGAGATGGAGGACGAT TGGATTTTATCCCTTCCGGGTAGTGAGTCTGTTGCGATCCTAACGAGGTGTTTAGACCGCACTGAGGAATCAATACAGAG ACTGCGCCTGCGCCAAGCTGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1086075: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10860752153659AA441781TEUF0099T.cruzi epimastigote non-normalized cDNA Library


Date: 1:13:50 on Tue 21 Nov 117.