EST 1090185 is a singleton


Sequence

>1090185 (1 EST) Length=615 CANGTTTGANAATCTNACGTGGTACTTGAATGANANGACGTGAAGTGTGANNTGTNTGGAAGTACTGATATACTTGAAGT TGACGATAATTNATGCCTGCNTAGTNCAGATTCCACTCTNACTGAAGGTGATGATGATCCTGATCCNATGTCGGANAAAA ATGCACAAGATATTATCCATCCGGACTCTCNCATGCTTAAAAACCGAGTGGGGATACCAGAGGTTCCACATTCGGGATTC AGTTTTCGAAAGTTGTGGGCCTTTATGGGTCCCGGATTTTTGATGAGCATAGCCTATTTGGATCCAGGAAATATTGAAAG CGATTTGCAATCAGGGTCACAAGCTGAGTATCGACTCCTGTGGGTTTTGCTATCTGCACATATTATTGGTTTGTTTCTTC AGCGATTATCCGCTCGTTTGGGTGTTGTAAGTGGCAGGCATATGGCAGAAGTGGCGTATGAATATTACCCACGAACGCCG CGGCTCCTTTTATGGGTAATGATTGAAATAACAATTATTGGAAGCGATATGCCGGAAGTTATCGGTACATCGATTGCAAT CTATCTTGTACTGGAGGCTGGATTCCTTTATACATTGGGCGTTCTCATTACCGTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1090185: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10901852158556AA445891SWAMCA1730SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 7:21:6 on Mon 20 Nov 117.