EST 1090187 is a singleton


Sequence

>1090187 (1 EST) Length=490 CGGCACGAGCGGCACGAGCAAGTTTGAGGGAAATATATTNGACNATNGTGTCACAGTGGAAAANTGGTAATCACNAAACA GAAACANTANGAGCTGTCACTGANNATTGTNTGGATGANGTGGACATGGAGACANTGAAANTCNTCCAGGAGCNATTCCT CTCTGCCGANGCAATTGAAATTACTGAAGTTANCGAGCACTCCAANCAGGTTAAATNCNAANCTCAAACTNTGTGGAGGA ATGTGGCGCTATTTTCAACTCTCCANGTAGCGGCACTGGTCGGTATTTAACANTGAATTTTCCTCGCCAAATGGCCAACA TTATTTTGGTATTGCACCTGTTGGCTAATGGGCGTTATGGGTATCACTGCTGGGGCACATCGTCTTTGGTCTCATCGTAN TTATAAGGCCANATGGCCTGCNCGGCNCTTTTTGATGTTTTGCAACAGTATGGCTTTCCAGAACGATGTANTTGAGTGGT CACGAGACCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1090187: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10901872158558AA445893SWAMCA1734SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 15:36:7 on Fri 24 Nov 117.