EST 1090189 is a singleton


Sequence

>1090189 (1 EST) Length=617 CAAGTTTGAGAGATATGGCTTTAGCACTGTTAAGTGTCAACATTTGTCAGTTCAGTGGCTGCGGACTTAACTTTGGAAAC CTCCATGATTTGCTTCAGCACATCGAGGAGACACATATCCCTATAATCGAGGATGAAATGAAGAAGAAAGAAGAAAATGC TAAAAACTCTTCTCTGGACGATGATCCTTCGAAAGCTGCGGCATTAACCGCTGTTTTTCCAATAAGCACAATTTGCAAGT TATTTTCAAAACTTCCTCCTCATAAAGCAGTTCCGATTAATCCCGAACCTGTGAAGCTTGCGATTGGCCACTACAGGAAA AAAACATTAGCGTCTGCAGTTGTCGGTGCGAATGTTTTTGGACAAGCTGGAGACAAATCACGTTTTGATCAACATGATGA AGAATCAAATGATTTATACAGAAAACGAGGACTGTGATGACTATGAGCAGGGCACGGATGAAAGGCGACACAAATGTCCA GTTGAAGGATGCAACAAACGATACAAGAATCTGCAAGGAGCACGTTATCATGCGCGTCAAGTACATGGCTATAGTGANGA TAACGGCACCAATAATGCAGTATCGTTTGACTTGACTGCTGTGGTGCCTGGACAATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, Processing,


Cluster Information for 1090189: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10901892158560AA445895SWAMCA1736SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 19:27:47 on Sun 19 Nov 117.