EST 1090190 is a singleton


Sequence

>1090190 (1 EST) Length=592 TACTTTCTGGACTAGTACATTTCTTGAGGCGACGAGTTCGGCCACCTGGACCTGAGTCTGAGCACTGCTTGCTAGGTAGT GAGCCGACATGTTGCTCCACTGCCAGGTTATCCTCGCCACAACGACAACACATCGATGCTTTGCTGAAGCGTTTGAAGAC AAAACTTGCTTGTGAACCTGAAGATCGGGCCAATGGAGTAGATGATGAATGCTGTGTATGTGTGCAGCGGCGTGCATCAG TTCGAGCCTTTCCTTGCAGCCATAAAGTATTCTGCAGGAACTGTGCGGTCCAGTTAATTGAGCATGCAATCAACGAGAAC AGAATGCGGATGAGCTGCATAATATGTCGTCGTGATATCGCAAGGTTGCAGTATAGTCGGCCATCACGTTCTGCACAAAT TCGTAAGCAGCAGGCGTTTCTTGAAGATAATGACAGCAGGAACAGTAATACTTCCACTACTACTGCTTTTACTACTGTCC GTGTTCTGAATAATGCAATTTGGTGTACCCGGATGTTTTCTCCAAATATTCATGTCAGAATTTCCCTATGCCTGTTACTC TTTCGTCTTCTCAATAAACTTTTTTTTCCGTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1090190: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10901902158561AA445896SWAMCA1737SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 7:29:37 on Sun 19 Nov 117.