EST 1090199 is a singleton


Sequence

>1090199 (1 EST) Length=750 CATAATTCCATCAAAGATTTCCGACATAAAATTGTCACATATTATTGCATCAAAGAAGTAATCACGAAAGAATGATAAGA ATCACAATGTTTCATTGTTGAATTATTTAATTTACTACAATGTGTACACTTCGTGAATTTATATCGGACGATGATTTGGA TGAAGCATTTCGGATGTTGATGAATTGTTCACCTCATATGATACCAATTTATGATACTGTGCGAATTCATCGAATTANAA GGTGTCCAACAGCGAAATTTCGCATTTTCGGTTATCCATTTACGGAATCTAAATTATGGTTTTTACTGGGCGATGATCCT TTCAGAGTCCAATTTTTGCTTATTTGGAGTTTACCNTGGCTGAATAGCCAAAAAGATGAATTTTTGGATGCAATCTATCA ATTTACCAAATTAGTCGAATTGGCTAAAGAATTTCTTATTATCCATCCAGATTATTTATCTGATAAGATTTCCATTTATA TCAAATCAAAAACTTCATACGCCGAAAATATGTTTCCGACGTATATGTTTTACCTGAATGACAAGCAGCCANAAATAGTA TTGAAAGGAGAAACTGTCTTTAGCATCCTCTGATTATCCTATTATGTTGATAAACCCGAAGAAGATGCCTTGATATCCAT GATCCTGGCATATGCTGATAAGGAAACGGTCAATGTTTGCAAAAATTCGAAGCCCCGAATGTTATTTTCTTCTCCAGGAA AACGGTGCTTATGAAATATTAAATAAAGGN


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1090199: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10901992158570AA445905SWMFCA2031SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 16:27:27 on Mon 20 Nov 117.