EST 1090200 is a singleton


Sequence

>1090200 (1 EST) Length=591 GGACAAGGCCAGACACTACAGGTAACGGGGTTGAAAGGCCCTGTGCTCCGACTTCGAGAGCCGCTGGGAGTTCTGGCTGT GGTATGCCCAGATGAGTGGCCCCTGCTGGCCTTCGTGTCGCTGCTGGCCCCTGCCCTGGCCCACGGCAACGCTGTGGTCT TAGTACCCAGTAGGGCCTGTCCTCTGCTGGCCCTGGAGATCTGTCAGGATATGGCTACCCTGTTCCCTGCTGGCCTGGTG AACGTAGTGACAGGAGATCGGGACCACCTGACCCGCTGCCTGGCCTTACATCAGGACGTCCAGGCCCTGTGGTACTTCGG CTCTGCCCAGGGTTCCCAGTTTGTGGAATGGGCCTCTGCAGGAAACCTTAAATCTATATGGGTAAACGGGGGCTCCCCCA AGGCCTGGGATGTGGAAGTCGAAGGGGCTGGACCCGAGCTGAATCTGCGAGCAGCACGAACCAAGGCCCTGTGGCTGCCA ATGGGGGACTGATGCCTGAAGCCAGCCTGCTAGCCCAAGGATGTCAGACACTTGGGAACTTTTCTCTCAGACTTCCCATG GCTTCCAATAAACTGAATGAATTCCACTGTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1090200: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10902002158571AA445906SWMFCA2171SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 9:8:52 on Tue 21 Nov 117.