EST 1098736 is a singleton


Sequence

>1098736 (1 EST) Length=327 GCACGAGTGGAGGACAGTTGGTGCAATGCTGAGAGCATCTTTCTCCTCCCAGTGTTTTCAATTTTTATAAAAGAAACTCA AAGGATGCAAAAATGCCTTCAATTCTCAACACGATGTTTCTTTCCGCATTCATCTTTTGTTCCTTCATTTATACCATACC AACGATGACAAGTGTAAGAGTCATAAGACGTGATACGGCAGCAATATTACAAAAAATGCACAACAATTTGCGGGAGAACT GTTTCCCACGACCAAGTGGTGGATGTGCATGTACTGTTAAACAAGGGGACGGTGTAGAAACTGTCGAAATTACGATCAGT GAACAGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1098736: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10987362167906AA454237RRAMCA149SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 3:51:14 on Sun 19 Nov 117.