EST 1098744 is a singleton


Sequence

>1098744 (1 EST) Length=256 CAATAATTTTCCCAATGCATTTGTTAGAATATCTGATCTTAATGTTCTTGATTATGATTGGAAGTTAAAAGATCTTGCTA TTATTACTTTGTTATATCAAAAAGTATTTGATATATCAGTTTGCGACTATATATTACCCAATGATTTAAAATTCGAAGTT TCCATGCGATTATTACGGAATCCAATAATGTGAAATGCTAGTAATCGCTTGAAGTGAAATTTCTCAAATTTCTTTCATTC AAAGTGCTTTATTAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1098744: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10987442167914AA454245RRAMCA300SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 0:24:48 on Fri 24 Nov 117.