EST 1098747 is a singleton


Sequence

>1098747 (1 EST) Length=124 ATATTGTTTCACTAATTAATCCGTGCGTCTTGTTCGTTTATGCCCTTTTCTATAATGGTTTTTGTTAGCGAGATTTATTG GTTTAAATTTCATTCAGAAATTTGTCTTAAAATATATGCAGAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1098747: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10987472167917AA454248RRAMCA312SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 14:24:21 on Fri 17 Nov 117.