EST 1098758 is a singleton


Sequence

>1098758 (1 EST) Length=215 TGGAATACTAACTGGAAAAAAGGGAACGTTGTTGGATATGTTCTTAAGGATTAAAAATGGATAACCCAAAGTAACAAATG CGAGATCACTTGGATCTGGGCATGATCTCGAGCACGAGGAGGATGAAGCCGTGCATCTACTGCACAGAGCTGACCTGCAT CCGTTTCCTTATTACAGGTAAGGAGAAGTCGACGGCGAGGTTCACGGAGTCGCTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1098758: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10987582167928AA454259RRAMCA351SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 15:14:27 on Wed 22 Nov 117.