EST 1098784 is a singleton


Sequence

>1098784 (1 EST) Length=200 TTATCTGTTGTTTTTTACTCTCTTTTCATTACTTTTATTCTTGTATATCTATTTAAATCAGTCTTTTATTCGTTCTACAG TAGTAGGAAGTATATTTCATTGAGGGAAAGCATGTCATTTGTTAGTTATATACACGTTTGTTTTCTAGCGTGATACGTCT ACGCTTGCATCCCTTCTTTTCGAATCTAATATTCTGATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1098784: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10987842167954AA454285RRAMCA453SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 0:40:59 on Fri 24 Nov 117.