EST 1098796 is a singleton


Sequence

>1098796 (1 EST) Length=275 AAGTACCGATCNATCAGAAGCAGGTNTTTNTTTAGCACTTTTGGTCTAGCTAATATTGTATGTCAAAGTGACCAACCAAT CATTCTTAAGTTATTTAGCGGAAATGGAATTAAATAAATAGCAGAACTAACAGTATAATAGAGAAGATGGTATGTTAAAT ACTACTTTTATATGTGGATTATAGTTTCACCGCAGTATACTGGTGAGTCGAATCAGTTCGAACATCTGTAAGTCGGATCG ATGGATCTTAACAGAAGGTCATTTGCATGATATAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1098796: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10987962167966AA454297RRAMCA477SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 16:14:53 on Tue 21 Nov 117.