EST 1098813 is a singleton


Sequence

>1098813 (1 EST) Length=521 AGTTAGACTTGTAATTTGCTATTTAAACTATGCTACTGCCTATTTCGATGGAAGATTTGGAATTATTTCCTAAAAACAAG CAATTAATAGTACCTAAATTACCGATTGCACAATTTTCGCCAGATGAATTTGAGCAGATGCGTAATCAGTTAGCAAAAAT TTGGTGGTCACGTCTTATTATCGCTGTACGTGGTTACGTTGCAAATTATATTGAAGATAATGATGAGAAATTATNTCTTG CTGATGATGCATTTATTATTATTCATCGTTATCTTGTCGAATCAAACGTAACGGATGCTATACAACAGTTTTTAATTGAT CTGGAATTTATTGTTAATTATCCAAATGTAATTACAATTCTTAACGATCTCAGTAATGGCTTTTCAAAATATAATCCATT TGTTGATCCTAAAAGTAACAATCATTTTATCAGGATTTACGGGGAACCGGATAGATGAACATATCGTGTTGCAAATGCTC AAATTATTGCTCATATTATATTCATGCATATATTTTTGATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1098813: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10988132167983AA454314MBAFCX0B04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 11:20:31 on Sun 19 Nov 117.