EST 1098846 is a singleton


Sequence

>1098846 (1 EST) Length=408 CTTCAAGGCGTGTTAATGGCCGCTATTCGTAAAAAATTGGTCATCGTTGGTGATGGCGCTTGCGGCAAAACTTGCCTTTT AATCGTGTTCAGTAAGGATCAGTTCCCAGATGTTTATGTACCAACGGTGTTTGAAAATTATGTTGCAGATATTGAAGTGG ACGGGAAACAGGTGGAACTAGCTTTGTGGGATACCGCGGGCCAAGAAGATTATGATCGATTAAGACCACTCAGTTATCCG GATACTGATGTAATCTTGATGTGTTTTAGCATTGATTCACCGGACTCGTTAGAAAACATTCCAGAAAAGTGGACACCTGA GGTGCGTCATTTTTGCCCAAATGTTCCAATAATTTTGGTTGGCAATAAGAAAGACCTACGCAACGACCCACAGATGGTAC GTGAATTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 1098846: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10988462168016AA454347MBAFCX0E04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 17:55:55 on Fri 17 Nov 117.